A class template that holds a choice of seqan3::field.
More...
#include <seqan3/io/record.hpp>
template<field... fs>
struct seqan3::fields< fs >
A class template that holds a choice of seqan3::field.
- Template Parameters
-
| fs | The fields you wish to be present in the seqan3::record returned by your file. |
- See also
- seqan3::record
This class acts as a compile time list of seqan3::field elements. It is used in specialising file classes to determine the elements in a seqan3::record.
Example
auto input = R"(> TEST1
ACGT
> Test2
AGGCTGA
> Test3
GGAGTATAATATATATATATATAT)";
int main()
{
auto record = fin.
front();
auto &
seq = record.sequence();
}
decltype(auto) id() &&
The identifier, usually a string.
Definition sequence_file/record.hpp:55
Provides seqan3::debug_stream and related types.
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition debug_stream.hpp:38
@ seq
The "sequence", usually a range of nucleotides or amino acids.
Definition record.hpp:62
Provides seqan3::sequence_file_output and corresponding traits classes.
Provides the seqan3::record template and the seqan3::field enum.
A class template that holds a choice of seqan3::field.
Definition record.hpp:125
The documentation for this struct was generated from the following file: